Rice (Oryza sativa L.) is one of the major food crops in the world (Liu et al., 2010). Its planting area in China is up to 3.0×10⁷ hm², and its total output is 2.0×1011 kg, accounting for about 34% of the total grain output in China, which is crucial to national food security (Zeng, 2018). Bacterial blight is one of the most serious diseases of rice (Huang et al., 2012), which is caused by the infection of rice varieties of Gram-negative bacteria Xanthomonas oryzae pv.oryzae (Xoo) (Khush, 2005; Zhai and Zhu, 1999). It can cause 10%~30% reduction in rice yield, and can reach 50% in severe cases. At tillering stage, infection of rice will lead to total crop failure (Mew, 1987). At present, the cultivation of rice resistant varieties is the most economical and environmentally friendly way for disease resistance (Sanchez et al., 2000; Singh et al., 2001). The application of molecular mark assisted breeding avoids the disadvantages of traditional breeding such as low efficiency, low accuracy, and high cost.

So far, 27 dominant genes and 17 recessive genes resistant to bacterial blight have been reported, with a total of 44 (Liang et al., 2017; Kim, 2018). Among them, Xa23 gene is derived from the Chinese common wild rice (Oryza rufipogon Griff). Xa23 gene is a dominant gene with broad spectrum and strong resistance to most Chinese bacterial blight pathogenic races, Philippine races, and Japanese races (Zhang et al., 2000; Zhang et al., 2001). Xa23 gene was found in Chinese wild rice in 1987. After that, Zhang et al. (2000) cultivated the near isogenic line CBB23 of Xa23 gene, and Xa23 gene was mapped on chromosome 11 by SSR markers. Then the position of Xa23 was accurately located on the long arm of chromosome by molecular markers SSR and RAPD (Pan et al., 2003). Further study found that AFLP marker APKj23 was more closely linked to Xa23, and the mapdistance between APKj23 and Xa23 was about 1.0 cM (Zhang et al., 2002; Wang et al., 2005). The Xa23 gene was located between the two molecular markers Lj138 and A83B4, and the molecular marker Lj74 co-segregated with the Xa23 gene was found (Wang et al., 2005; Wang et al., 2014). Subsequently, Xa23 gene and its corresponding avirulent gene avrXa23 were cloned one by one. avrXa23 is a transcription activator-like effector (TALE) widely existing in bacterial blight, which can recognize a specific DNA sequence with length of 28 bp (TALE binding element, EBE) on the promoter of Xa23 gene, thereby activating Xa23 gene expression. However, the promoter region of allele susceptible gene xa23 lacks avrXa23 specific binding region and cannot be induced to express (Wang et al., 2015).

In this study, the Xa23/xa23 promoter sequences of wild rice and common cultivated rice were analyzed, hoping to reveal the variation of Xa23 and xa23 promoter regions, so as to design effective functional markers, and provide technical support for improving rice bacterial blight resistance by using Xa23 gene.

1 Results and Analysis

1.1 Xa23 gene promoter amplification

The primers Xa23PF and Xa23PR were used to detect Xa23/xa23 in 43 common wild rice varieties and 7 cultivated varieties in China and abroad by PCR. The results showed that there were only 9 obvious amplification products in 43 wild rice samples such as No.8, No.9, No.11, etc., and the detection rate was only 20.9% (Figure 1; Table 1). Only TP309 and Nipponbare could amplify bright bands in the 7 conventional rice cultivars, while 9311 and the germplasms (IRBB5, IRBB21 and IRBB27) with a single resistance gene to bacterial blight, had no obvious specific amplification, indicating that Xa23/xa23 had a low presence rate in wild rice and conventional rice (Table 1).

According to the PCR products and the sequence size of amplified fragments, Xa23/xa23 promoter amplified products could be divided into four types: (1) No amplification products, such as wild rice No.1, No.2, No.3, etc. (2) The size of amplified product was about 750 bp, such as No. 8 and No. 9 common wild rice. (3) The size of product was about 650 bp, such as TP309, Nipponbare, etc. (4) The size of product was about 550 bp, such as CBB23, No.21, No.23 common wild rice, etc. (Figure 1).

1.2 Abundant variations in Xa23 gene promoter

The 200 bp sequence upstream of the starting codon of Xa23 was compared and analyzed. Results showed that EBEavrXa23 was located between -125 and -98 bp in the sequence 200 bp upstream of the start codon ATG. The allelic sequence of EBE_avrXa23 (ebe_avrXa23) had abundant variations in other rice germplasms and could be divided into 8 haplotypes. In addition to the H0 type (IR24, O. longistaminata, O. barthii, O. glaberrima) with no obvious consistent sequence with EBE_avrXa23, there are at least 7 haplotypes in EBE_avrXa23, such as H1 represented by CBB23, H2 represented by JG30, H3 represented by 9311, H4 represented by O. meridionalis, H5 represented by O. glumaepatula, H6 represented by Nipponbare, and H7 represented by wild rice 200 (Figure 2). By comparing the 200 bp nucleotide sequence upstream of the start codon, it was found that in all 34 groups of Xa23/xa23 promoter sequences, EBE_avrXa23 sequence only existed in CBB23, and the H2 haplotype represented by JG30 with the highest nucleotide sequence consistency, which was 98%~99%. The lowest is the H0 type that does not have obvious consistenc y sequence with EBE_avrXa23, and the consistency is between 35% and 46% (Table 2).

1.3 The design of Xa23 function mark

EBE_avrXa23 only exists in the Xa23 promoter and has great difference with other xa23 alleles. Therefore, the designed upstream primers of Xa23 functional marker are partially located on EBE_avrXa23 (Figure 2). Firstly, the rice CBB23 with Xa23 gene was detected, and total DNA amplification of rice IR24, 9311, and Nipponbare without Xa23 gene was performed to detect whether the Xa23 functional marker was effective. Results showed that only the varieties with Xa23 gene could amplify a band of about 105 bp, while there was no amplified band without the Xa23 gene (Figure 3), indicating that the designed functional markers could distinguish whether there was Xa23 gene.

2 Discussion

About the variation of Xa23, a total of 278 representative materials (71 cultivated rice varieties and 207 wild rice varieties) were used as experimental objects to detect the presence of Xa23/xa23 (Cui et al., 2017; Cui, 2018). It was found that only 97 out of 278 rice materials could amplify the Xa23/xa23 gene. The sequences of the 97 groups were further analyzed, and the Xa23/xa23 promoter was divided into 5 haplotypes based on the 9 SNP loci and 2 InDel variation information on the promoter. In addition, 15 wild rice samples with EBE_avrXa23 sequence were also found.

In this study, it was also found that only 11 out of 50 rice materials could amplify the Xa23/xa23 gene, indicating that Xa23 was not widespread in rice. And EBE_avrXa23 only exists in rice CBB23. Besides, it was found that there were abundant variations in the sequence of EBE_avrXa23/ebe_avrXa23, in addition to the 4 sequences significantly inconsistent with EBEavrXa23, there were at least 7 haplotypes.

Because of the abundant variations in EBE_avrXa23/ebe_avrXa23, it is difficult to develop codominant markers for Xa23 that are widely used. The dominant functional marker of Xa23, which developed based on the EBE_avrXa23/ebe_avrXa23 sequence difference, may clearly detect whether the sample carries Xa23, but whether Xa23 is homozygous still requires other linkage markers of Xa23.

3 Materials and Methods

3.1 Experimental materials

In addition to the rice CBB23 (Xa23) carrying disease resistance Xa23 gene and the rice JG30 (xa23) carrying susceptible allelic xa23, 31 foreign common wild rice, 12 domestic common wild rice (named after the collection site), 7 common rice varieties IR24, Nipponbare, 9311, Taipei 309 (TP309) and the materials carrying single resistance gene against bacterial blight IRBB21(Xa21), IRBB27(Xa27), IRBB5(xa5) were used for sequencing and amplification of Xa23 promoter (Table 1).

3.2 PCR amplification of Xa23 promoter

The Xa23/xa23 promoter sequences of rice CBB23 (GenBank N.: KP123634.1) and JG30 (KP123635.1) were obtained from GenBank database. Through comparative analysis, promoter primer Xa23PF CTCTTCCCTGAGTCAAAGTC; Xa23PR: GGAGAATAACCATCTGTCG was designed to amplify Xa23.

The total DNA of rice leaves was used as the template for PCR amplification. The reaction system is as follows: 2×Taq PCR Mix 10 μL, ddH₂O 7 μL, primer Xa23PF 1 μL, primer Xa23PR (10 μmol/L) 1 μL, template DNA (50 ng/μL) 1 μL. The amplification conditions: pre-denatured at 95°C for 3 min, denatured at 94°C for 30 s, annealed at 55°C for 45 s, extended at 72°C for 1 min, 30 cycles, final extension at 72°C for 6 min, stored at 16°C. The PCR amplification products were electrophoretic in 1% agarose gel, and the bright PCR products were recovered. After the T vector was detected positive, the products were sent to the biological company for sequencing.

3.3 Acquisition and analysis of Xa23 Gene promoter sequence

In addition to the Xa23 allele DNA sequence obtained from the above amplification products, we also obtained O. longistaminata, O. barthii, O. glaberrima, O. punctata, O. meridionalis, O. glumaepatula, O. rufipogon from Gramene (http://www.gramene.org), obtained common rice varieties 9311, Nipponbare, Minghui 63, R498, Zhenshan97S, from RiceData (http://rice.hzau.edu.cn/cgi-bin/rice2/blast), and obtained Xa23 promoter allelic sequence from high-throughput sequencing of rice varieties IR24 data in this study. The nucleotide sequences about 200 bp upstream of the start codon of Xa23/xa23 were analyzed by using the subroutine Align X of the biological information analysis software Vector NTI. According to the characteristics of EBE_avrXa23 sequence, the haplotypes of Xa23 promoter were classified. In addition, the nucleotide sequence consistency of Xa23/xa23 promoter from different rice materials was counted.

3.4 Design and verification of Xa23 promoter functional marker

According to the difference of EBE_avrXa23 sequence in Xa23/xa23 promoter region of different rice varieties, a functional marker for detection of Xa23 gene was designed. And its primer sequence Xa23FunF: AAAGTCCCTTCCGAAACATC; Xa23FunR: ATGAGGAAGTGCTGCCAGA. The PCR amplification products were electrophoretic in 1% agarose gel, and then observed, recorded, and analyzed.

Authors' contributions

ZDD is the experimental designer and executor of this research. ZDD completed the data analysis and manuscript writing. FYL, JXY participated in the design of the study and performed the statistical analysis. XZH is the designer and director of the project, guiding the experimental design, data analysis, writing and revision. All authors read and approved the final manuscript.

Acknowledgments

This study was supported by the Natural Science Foundation of Hainan Province (318MS007), 2019 High-level Talents Project Fund for Basic and Applied Basic Research (Natural Science) in Hainan Province, 2019 Major Science and Technology Program in Hainan Province (2016ZX08001-002).

Reference

Cui H., 2018, Evolution mechanism of rice bacterial blight resistance gene Xa23 and analysis of important amino acids associated with HR function of XA23, Dissertation for Ph.D., Institute of Crop Sciences CAAS, Supervisor: Zhao K.J., pp.36-39

Cui H., Wang C.L., Qin T.F., Xu F.F., Tang Y.C., Gao Y., and Zhao K.J., 2017, Promoter variants of Xa23 alleles affect bacterial blight resistance and evolutionary pattern, PLoS One, 12(10): e0185925
https://doi.org/10.1371/journal.pone.0185925

Huang X.H., Kurata N., Wei X.H., Wang Z.X., Wang A., Zhao Q., Zhao Y., Liu K.Y., Lu H.Y., Li W. J., Guo Y.L., Lu Y.Q., Zhou C.C., Fan D.L., Weng Q.J., Zhu C.R., Huang T., Zhang L., Wang Y.C., Feng L., Furuumi H., Kubo T., Miyabayashi T., Yuan X. P., Xu Q., Dong G.J., Zhan Q.L., Li C.Y., Fujiyama A., Toyoda A., Lu T.T., Feng Q., Qian Q., Li J.Y., and Han B., 2012, A map of rice genome variation reveals the origin of cultivated rice, Nature, 490(7421): 497-501
https://doi.org/10.1038/nature11532
PMid:23034647 PMCid:PMC7518720

Khush G.S., 2005, What it will take to feed 5.0 billion rice consumers in 2030, Plant Mol. Biol., 59(1): 1-6
https://doi.org/10.1007/s11103-005-2159-5
PMid:16217597

Kim M.S., 2018, Identification of novel recessive gene xa44(t) conferring resistance to bacterial blight races in rice by QTL linkage analysis using an SNP chip, Theor. Appl. Genet., 131(12): 2733-2743
https://doi.org/10.1007/s00122-018-3187-2
PMid:30225642 PMCid:PMC6244528

Liang L.Q., Wang C.Y., Zeng L.X., Wang W.J., Feng J.Q., Chen B., Su J., Chen S., Shang F.D., Zhu X.Y., and Lin F., 2017, The rice cultivar Baixiangzhan harbours a recessive gene xa42(t) determining resistance against Xanthomonas oryzae pv.oryzae. Plant Breeding, 136(5): 603-609
https://doi.org/10.1111/pbr.12493

Liu J.L., Wang X.J., Mitchell T., Hu Y.J., Liu X.L., Dai L.Y., and Wang G.L., 2010, Recent progress and understanding of the molecular mechanisms of the rice-Magnaporthe oryzae interaction, Molecular Plant Pathology, 11(3): 419-427
https://doi.org/10.1111/j.1364-3703.2009.00607.x
PMid:20447289 PMCid:PMC6640493

Mew T.W., 1987, Current status and future prospects of research on bacterial blight of rice, Annual Review of Phytopathology, 25(1): 359-382
https://doi.org/10.1146/annurev.py.25.090187.002043

Pan H.J., Wang C.L., Zhao K.J., Zhang Q., Fan Y.L., Zhou S.C., and Zhu L.H., 2003, Molecular mapping by PCR-based markers and marker-assisted selection of Xa23, a bacterial blight resistance gene in rice, Zuowu Xuebao (Acta Agronomica Sinica), 29(4): 501-507

Sanchez A.C., Bara D.S., Huang N., Li Z., and Khush G.S., 2000, Sequence tagged site marker-assisted selection for three bacterial blight resistance genes in rice, Crop Science., 40(3): 792-797
https://doi.org/10.2135/cropsci2000.403792x

Singh S., Sidhu J.S., Huang N., Vikal Y., Li Z., Brar D.S., Dhaliwal H.S., and Khush G.S., 2001, Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106, Theor. Appl. Genet., 102(6-7): 1011-1015
https://doi.org/10.1007/s001220000495

Wang C.L., Fan Y.L., Zheng C.K., Qin T.F., Zhang X.P., and Zhao K.J., 2014, High-resolution genetic mapping of rice bacterial blight resistance gene Xa23, Molecular Genetics and Genomics, 289(5): 745-753
https://doi.org/10.1007/s00438-014-0848-y
PMid:24715026

Wang C.L., Qi H.X., Pan H.J., Li J.B., Fan Y.L., Zhang Q., and Zhao K.J., 2005, EST-markers flanking the rice bacterial blight resistance gene Xa23 and their application in marker-assisted selection, Zhongguo Nongye Kexue (Scientia Agricultura Sinica), 38(10): 1996-2001

Wang C.L., Zhang X.P., Fan Y.L., Gao Y., Zhu Q.L., Zheng C.K., Qin T.F., Li Y.Q., Che J.Y., Zhang M.W., Yang B., Liu Y.G., and Zhao K.J., 2015, XA23 is an executor R protein and confers broad-spectrum disease resistance in rice, Molecular Plant, 8(2): 290-302
https://doi.org/10.1016/j.molp.2014.10.010
PMid:25616388

Zeng B., 2018, Renovation of main cultivated rice varieties in china in the past 30 years, Zuowu Zazhi (Crops), (3): 1-7

Zhai W.X., and Zhu L.H., 1999, Rice bacterial blight resistance genes and their utilization in molecular breeding, Shengwu Gongcheng Jinzhan (Progress in Biotechnology), 19(6): 9-15

Zhang Q., Wang C. L., Zhao K. J., Yang W.C., Qiao F., Zhou Y.L., Jiang Q.X., and Liu G.C., 2002, Development of near-isogenic line CBB23 with a new resistance gene Xa23 to bacterial blight in rice and its application, Zhongguo Shuidao Kexue (Chinese Journal of Rice Science), 16(3): 206-210

Zhang Q., Wang C.L., Zhao K.J., Zhao Y.L., Caslana V.C., Zhu X.D., Li D.Y., and Jiang Q.X., 2001, The effectiveness of advanced rice lines with new resistance gene Xa23 to rice bacterial blight, Rice Genet. Newslett, 18: 71-72

Zhang Q., Zhao B.J., Zhao K.J., Wang C.L., Yang W.C., Lin S.C., Jue G.S., Zhou Y.L., Li D.Y., Chen C.B., and Zhu L.H., 2000, Idientifying and mapping a new gene Xa-23(t) for resistance to bacterial blight (Xanthomonas oyrzae pv.oryzae) from O.rufipogon, Zuowu Xuebao (Acta Agronomica Sinica), 26(5): 536-542